Identification of circulating tumour cells in early stage breast cancer patients using multi marker immunobead RT-PCR

1756-8722-2-24 1756-8722 Research Identification of circulating tumour cells in early stage breast cancer patients using multi marker immunobead RT-PCR Raynor P Michael michael.raynor@adelaide.edu.au Stephenson Sally-Anne s.stephenson@qut.edu.au Pittman B Kenneth ken.pittman@nwahs.sa.gov.au Walsh CA David david.walsh@adelaide.edu.au Henderson A Michael michael.henderson@petermac.org Dobrovic Alexander alex.dobrovic@petermac.org

Department of Haematology/Oncology, The Queen Elizabeth Hospital, Adelaide, South Australia 5011, Australia

Department of Medicine, University of Adelaide, The Queen Elizabeth Hospital, Adelaide, South Australia 5011, Australia

Institute of Health and Biomedical Innovation, Queensland University of Technology, Kelvin Grove, Queensland 4059, Australia

Department of Surgery, University of Adelaide, The Queen Elizabeth Hospital, Adelaide, South Australia 5011, Australia

Department of Surgery, University of Melbourne and Peter MacCallum Cancer Centre, Locked Bag 1, A'Beckett St, Melbourne, Victoria, Australia

Department of Pathology, Peter MacCallum Cancer Centre, Locked Bag 1, A'Beckett St, Melbourne, Victoria 8006, Australia

Department of Pathology, University of Melbourne, Parkville, Victoria 3010, Australia

Journal of Hematology & Oncology 1756-8722 2009 2 1 24 http://www.jhoonline.org/content/2/1/24 19500345 10.1186/1756-8722-2-24 16 3 2009 05 6 2009 05 6 2009 2009 Raynor et al; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Abstract

Introduction

The ability to screen blood of early stage operable breast cancer patients for circulating tumour cells is of potential importance for identifying patients at risk of developing distant relapse. We present the results of a study of the efficacy of the immunobead RT-PCR method in identifying patients with circulating tumour cells.

Results

Immunomagnetic enrichment of circulating tumour cells followed by RT-PCR (immunobead RT-PCR) with a panel of five epithelial specific markers (ELF3, EPHB4, EGFR, MGB1 and TACSTD1) was used to screen for circulating tumour cells in the peripheral blood of 56 breast cancer patients.

Twenty patients were positive for two or more RT-PCR markers, including seven patients who were node negative by conventional techniques. Significant increases in the frequency of marker positivity was seen in lymph node positive patients, in patients with high grade tumours and in patients with lymphovascular invasion. A strong trend towards improved disease free survival was seen for marker negative patients although it did not reach significance (p = 0.08).

Conclusion

Multi-marker immunobead RT-PCR analysis of peripheral blood is a robust assay that is capable of detecting circulating tumour cells in early stage breast cancer patients.

Introduction

RT-PCR of peripheral blood mononuclear cells (PBMNCs) using lineage-specific markers is the most common published methodology for the detection of circulating tumour cells (CTCs) in the peripheral blood. RT-PCR was first used to detect circulating melanoma 1 and neuroblastoma cells 2. Due to the high levels of sensitivity necessary to detect rare cancer cells, nested RT-PCR is often used and therefore even low levels of illegitimate transcription in PBMNCs can cause false positive results 345. Nested RT-PCR is also time consuming and stringent procedures need to be observed in order to minimize the risk of false positives due to PCR product cross contamination.

We developed the immunobead PCR methodology using immunomagnetic beads coated with an epithelial cell specific antibody to enrich carcinoma cells from whole blood 6. When blood from a patient is incubated with antibody-coated beads, the beads attach to any epithelial cells that might be in the blood. The justifiable assumption is that the only epithelial cells in blood or bone marrow are carcinoma cells. A magnet can then be used to harvest these cells. A modification combining immunobead enrichment with RT-PCR detection of lineage-specific markers (immunobead RT-PCR, IB RT-PCR) was subsequently developed 7. This minimised the problem of illegitimate transcription, allowed the use of whole blood rather than the mononuclear cell fraction, and eliminated the requirement for nested RT-PCR.

We subsequently reported a strategy to identify sensitive and specific RT-PCR assays to be used in immunobead RT-PCR analysis 8. This method allowed the selection of a panel of RT-PCR markers suitable for immunobead RT-PCR. These included 2 novel markers ELF3 (also known as ESX) and EPHB4, as well as the previously used markers epidermal growth factor receptor (EGFR), TACSTD1 (also known as epithelial cell adhesion molecule – EpCAM) and mammaglobin 1 (MGB1). These markers were both sensitive enough to enable detection of a single tumour cell and specific enough not to be amplified from PBMNCs that may contaminate the immunobead-tumour cell pellet. In this new report, we assessed this panel of markers in a prospective study using peripheral blood samples from 56 predominantly early stage breast cancer patients.

Methods

Patient samples

Peripheral blood (10 ml) was collected in potassium EDTA tubes from 56 breast cancer patients ranging in age from 37–89 years who presented for pre-admission counselling prior to surgery at The Queen Elizabeth Hospital, Adelaide, Australia. The first 2 ml of blood was discarded to avoid contamination from the skin puncture. Peripheral blood was also collected from 10 normal individuals for use as negative control samples and in reconstruction experiments. Informed consent was obtained in all cases and ethics approval for this study was obtained from The Queen Elizabeth Hospital Ethics of Human Research Committee. The distribution of tumours according to the TNM classification system was 8 in situ, 17 Stage I, 21 Stage IIA, 9 Stage IIB, 1 Stage IIIA.

Cell lines

The breast cancer cell lines MDA-MB-231, MDA-MB-468, MDA-MB-453 and MCF7 were maintained in Dulbecco's Modified Eagle Medium (Invitrogen, Carlsbad, CA) in 75 cm²tissue culture flasks at 37°C in a 5% CO₂environment. The medium was supplemented with 100 U/ml penicillin, 100 μg/ml streptomycin, 160 μg/ml L-glutamine and 10% heat-inactivated foetal bovine serum (CSL, Melbourne, Australia). Cells were collected at < 90% confluency by trypsin digestion and centrifugation for 5 min at 1000 rpm, resuspended in phosphate buffered saline (PBS) and counted using a haemocytometer.

Reconstruction experiments

MDA-MB-453 cells were diluted in PBS and counted to give aliquots containing 10, 100, and 1000 cells. Triplicate aliquots were seeded into 10 ml of normal blood and analysed by immunobead enrichment and RT-PCR. Normal donor blood with no cells added was used as a negative control.

Immunobead-enrichment and RT-PCR detection of circulating epithelial cells

The immmunobead RT-PCR technique has been described previously 7. Briefly, each 10 ml patient blood sample was incubated with 4 million immunomagnetic Dynabeads M-450 (Dynal, Oslo, Norway), labelled with the monoclonal antibody BerEP4 (Dako, Gestrop, Denmark). Each tube was placed on a low speed-rotating mixer for 2 h at 4°C. Bead rosetted cells were isolated in each tube using a magnetic array (Dynal), enabling the beads to be washed 3 times in PBS to remove unbound PBMNCs. The bead/cell isolates were then transferred to a microcentrifuge tube.

The captured cells were then lysed in a 9.5 μl volume of solution containing 0.3% v/v Nonidet P-40 detergent (Sigma), 500 ng random hexamers (Pharmacia, Uppsala, Sweden), 20 U of RNasin (Promega, Madison, WI) and 10 mM DTT, then stored at -80°C until needed for reverse transcription. Reverse transcription was initiated by the addition of 5× First Strand Buffer, 200 U of Superscript II (Invitrogen), 0.5 mM of each deoxynucleotide triphosphate (Roche Applied Science, Mannheim, Germany), with ultra-pure water (Fisher Biotech, Perth, Australia) to a final volume of 20 μl. The reaction was incubated at 42°C for 50 min, and then the reverse transcriptase reaction was inactivated by incubation at 70°C for 10 min.

After reverse transcription, 3.9 μl of cDNA was used as the template in a single round of PCR amplification with 200 nM of each gene specific primer pair (Table 1), 1 U of HotStarTaq (Qiagen, Hilden, Germany), 2.5 mM MgCl₂, and 200 μM of each deoxynucleotide triphosphate, in the supplied PCR buffer. Cycling conditions included an initial denaturation step at 95°C for 15 min, then 1 min at each of 94°C, 66–68°C and 72°C for 45 – 55 cycles and a final extension of 7 min at 72°C. Amplification products were visualised by ethidium bromide staining following separation by electrophoresis through agarose gels. In each case, a negative control for the RT reaction, made up of the components of the RT reaction mixture with or without lysis mix, and without the addition of RNA, was used as the template in the PCR reaction (no cDNA made and therefore no amplification expected). The PCR negative control contained the reagents of the PCR reaction but lacked template. Cell line cDNA was included as a positive control for the PCR reaction. Genomic DNA (100 ng) was used to confirm that a product of equal size to the cDNA product would not be amplified from the DNA in the cell lysate.

Table 1

RT-PCR primers and PCR conditions.

Primer name

GenBank Accession Number

Sequence 5' – 3'

PCR annealing temperature

Size

ELF3 s

AF016295

CTCGGAGCTCCCACTCCTCAGA

ELF3 as

GCTCTTCTTGCCCTCGAGACAGT

68°C

188 bp

EPHB4 s

AB209644

CCCCAGGGAAGAAGGAGAGCTG

EPHB4 as

GCCCACGAGCTGGATGACTGTG

68°C

250 bp

EGFR s

AB209442

TGTGAGGTGGTCCTTGGGAATTTGG

EGFR as

TGCTGACTATGTCCCGCCACTGGA

66°C

339 bp

TACSTD1 s

BC014785

GGACCTGACAGTAAATGGGGAAC

TACSTD1 as

CTCTTCTTTCTGGAAATAACCAGCAC

68°C

186 bp

MGB1 s

AY217100

CGGATGAAACTCTGAGCAATGTTGAG

MGB1 as

CTGCAGTTCTGTGAGCCAAAGGTC

68°C

110 bp

Sequences are shown for sense (s) and antisense (as) primers. The annealing temperatures used for the PCR reactions and the PCR product sizes are also shown.

Statistical Analysis

Clinical follow-up was obtained through the Cancer Registry database at The Queen Elizabeth Hospital for the patients enrolled in the study. The database included disease stage (TNM staging system), tumour size and grade, ER/PR status, presence or absence of lymphovascular invasion, and date and cause of death. Frequency data was analysed with the Fisher Exact Test. Metastasis free survival was estimated with Kaplan Meier curves 9 which were compared with the log rank Test 10. All statistical tests were two sided and p < 0.05 was considered to be statistically significant. All statistical tests were performed using SPSS (version 16 Chicago, Illinois, USA).

Results

Sensitivity experiment

Ten, hundred and thousand cell aliquots of the MDA-MB-453 cell line were seeded into triplicate ten ml tubes containing blood from a single normal donor and evaluated for the sensitivity of detection of the five immunobead RT-PCR markers (Figure 1). Blood samples containing no added cells were negative for all markers. Blood samples containing an estimated 100 or 1000 seeded cells were positive for all 5 markers in 3/3 replicates. In samples containing an estimated 10 seeded cells, TACSTD1 was detected in 2/3 replicates, ELF3 was detected in 2/3 replicates, EGFR was detected in 1/3 replicates, EphB4 was detected in 1/3 replicates while MGB1 was not detected. No other markers were positive in the samples that were negative for TACSTD1 suggesting that no MDA-MB-453 cells were captured with the BerEp4-conjugated beads from these samples as TACSTD1 codes for EpCAM which BerEp4 recognises.

Figure 1

IB RT-PCR sensitivity test on dilutions of MDA-MB-453 in normal blood

IB RT-PCR sensitivity test on dilutions of MDA-MB-453 in normal blood. Cells were added to 10 mls of normal blood. Lane 1, M = pUC19/HpaII marker. Lanes 2–4, no added cells. Lanes 5–7, 10 added cells. Lanes 8–10, 100 added cells, Lanes 11–13, 1000 added cells. Lane 14, C = cDNA positive control. Lane 15, R = RT negative control. Lanes 16–18, N = PCR negative controls. Product size is shown in base pairs (bp). A genomic DNA band is seen above the RT-PCR band for ELF3. The legend shows cells/10 ml of blood.

Immunobead RT-PCR analysis of blood samples

The expression of each of the five RT-PCR markers was assessed in the immunomagnetically enriched fraction of blood samples obtained prior to surgery from 56 early stage breast cancer patients (Table 2). One hundred nanograms of cDNA from MDA-MB-468, MCF7, MDA-MB-453, or MDA-MB-231 breast cancer cell lines were used as positive controls for each RT-PCR assay.

Table 2

Clinical details and RT-PCR positivity data.

Stage

Grade

LVI

TACSTD1

EPHB4

ELF3

EGFR

MGB1

in situ

Tis

in situ

Tis

in situ

Tis

in situ

Tis

in situ

Tis

in situ

Tis

in situ

Tis

In situ

Tis

IIa

IIb

IIIa

Stage, tumour size (T), nodal status (N), estrogen receptor status (ER) and progesterone receptor status (PR), lymphovascular invasion (LVI), tumour grade, and positive or negative expression of the 5 RT-PCR markers are shown for the 56 breast cancer patients. ND denotes no data. x denotes unknown.

In 20 cases, at least two markers were positive (36%). Of these 20 cases, 8/20 (40%) showed expression of all five markers, 8 (40%) were positive for four markers, 3 (15%) were positive for three markers, and 1 case (5%) was positive for two markers. Two patients, one positive for ELF3 only (patient 6), and one for TACSTD1 only (patient 15) were excluded from analysis because it was considered unlikely these results were due to disseminated disease (see Discussion). Blood samples from 10 normal donors were analysed in an identical manner to those blood samples obtained from breast cancer patients, and were found negative for all RT-PCR markers (data not shown).

Expression of RT-PCR markers by stage

The expression of RT-PCR markers was evaluated by clinical stage for the 56 patient samples (Table 2, column designated Stage). Positive RT-PCR marker expression was detected in 1/8 (12.5%) patients considered to have in situ disease, 3/17 (17.6%), patients with Stage I disease, 7/21 (33.3%) patients with Stage IIa disease, 8/9 (88.8%) patients with Stage IIb disease and the one patient with Stage IIIa disease.

In a comparison of in situ and stage I patients versus Stage IIa and Stage IIb patients, there was a statistically significant increase in the frequency of marker positivity in the higher stage patients (p = 0.008). There was also a statistically significant increase in the frequency of marker positivity for Stage IIa versus Stage IIb patients (p = 0.007).

Expression of RT-PCR markers by tumour size

Nine of the 28 patients (32%) that had tumours ≤ 2 cm in greatest dimension (T1) were RT-PCR positive (Table 2, column T). Eight of the 19 patients (42%) that had tumours > 2 cm but not more than 5 cm (T2) were RT-PCR positive. Both patients with tumours > 5 cm (T3) were RT-PCR positive. When in situ and T1 patients were compared to T2 and T3 patients, the observed trend to increasing numbers of patients that were positive for PCR markers did not reach significance (p = 0.08).

Expression of RT-PCR markers by lymph node status

Lymph node involvement for all patients in the study had been assessed using haemotoxylin and eosin staining (Table 2). Certain patients had their sentinel lymph nodes also assessed by immunohistochemistry. In total, 15/56 (27%) patients showed metastasis to one or more lymph nodes. Eleven of the 15 (73%) patients with positive lymph nodes were also positive for expression of RT-PCR markers in blood. Two of three patient's where lymph node involvement could not be assessed, were marker positive. Importantly, 7/41 (17%) patients who were considered node negative by conventional techniques were positive for at least two of the RT-PCR markers, with six of these patients showing positive expression of three or more markers. Nevertheless, lymph node positive patients were more likely to be RT-PCR positive (p = 0.00015).

Expression of RT-PCR markers by grade

Of the 56 patients, 18 were classified as having Bloom and Richardson Grade I (well differentiated) tumours, 20 were classified as Grade II (moderately differentiated) tumours and 12 were classified as Grade III (poorly differentiated) tumours (Table 2). For six patients, Bloom and Richardson grading was not available. Five of 18 (28%) Grade I patients, 6/20 (30%) Grade II patients, 8/12 (66%) Grade III patients, and 1/6 patients where tumour grading was not available, were RT-PCR positive. RT-PCR marker positivity was statistically higher (p = 0.01) in patients with Grade 3 tumours compared to those with Grade 1 and 2 tumours.

Expression of RT-PCR markers by lymphovascular invasion (LVI)

Fourteen patients were determined to have LVI present (Table 2, column LVI) and 10/14 (71%) were RT-PCR positive. LVI was not observed in 42 patients and of these, 10/42 (24%) were RT-PCR positive. The association of LVI and RT-PCR positivity was statistically significant (p = 0.002). LVI did not appear to be associated with grade, nodal status, or ER/PR status. There was however, a tendency for LVI to be associated with stage of disease and tumour size with the majority of patients that were LVI positive being Stage IIa or above with tumours classified as T2.

Expression of RT-PCR markers by ER/PR status

ER/PR status was available for 48 of the 56 patients. Of the 38 ER positive patients, 12 (31%) were positive for RT-PCR markers and 5/10 (50%) of the ER negative patients were positive. Of the 38 PR positive patients, 11 (29%) were marker positive, and of the 10 PR negative patients, 6 (60%) were marker positive. There was no significant association with ER status and marker positivity (p = 0.2) although there was a trend towards marker positivity in ER negative patients. There was a marginally significant association found between marker positivity and PR status (p = 0.04).

Individual RT-PCR Marker expression

Transcripts corresponding to TACSTD1 and EPHB4 were amplified in 20/20 (100%) of cases. Transcripts corresponding to ELF3 were amplified from 18/20 (90%), EGFR from 17/20 (85%), and MGB1 transcripts were amplified from 8/20 (40%) of samples. There appeared to be no strong association with the individual expression of TACSTD1, EPHB4, ELF3 and EGFR and any of the prognostic factors examined above (data not shown). A representative group of patients positive for IB RT-PCR marker expression is presented in Figure 2.

Figure 2

IB RT-PCR analysis for a representative group of 10 breast cancer patients

IB RT-PCR analysis for a representative group of 10 breast cancer patients. Patient number corresponds to numbers provided in Table 2. Product sizes are shown in base pairs. M = pUC19/HpaII marker. A genomic DNA band is seen above RT-PCR band for ELF3.

Survival analysis

Kaplan-Meier survival analysis was performed using recurrence or death from disease as endpoints. The log-rank test was used to compare survival curves of breast cancer patients positive or negative for RT-PCR markers. There was no significant difference between the 2 groups (p = 0.09) (Figure 3) but a strong trend was seen towards poorer survival for patients positive for RT-PCR markers.

Figure 3

Disease free survival for 56 patients with early stage breast cancer

Disease free survival for 56 patients with early stage breast cancer. Comparing patients positive for RT-PCR markers (2 or more) with patients negative for RT-PCR markers (0 or 1).

Discussion

Identification of epithelial cells in the peripheral blood of patients with breast cancer may be used to identify patients in whom haematogenous dissemination of tumour cells has occurred. However, the prognostic relevance of CTCs in the blood of patients with early stage disease, without overt metastasis, is still under investigation. Several studies have suggested that with the development of improved detection techniques, detection of CTCs will provide significant prognostic information [reviewed in 1112131415].

Many recent studies have aimed to improve the methods of detection and finding new markers for CTCs. Multi-marker RT-PCR assays have become widely used for detecting both lymph node involvement and CTCs in breast cancer patients [e.g. 1516171819202122]. We previously reported a panel of markers that allowed the sensitive and specific identification of a single breast cancer line cell, even if isolated with as many as 100 contaminating haematopoietic cells 8. We have now estimated the sensitivity of detection in reconstruction experiments using immunobead capture of the MDA-MB453 breast cancer cell line diluted into blood samples followed by RT-PCR for the panel of markers. Seeding dilutions of MDA-MB453 into normal blood resulted in consistent detection of all 5 RT-PCR markers at a level of 10 cells per ml of blood (Figure 1). In samples containing 1 cell per ml of blood (10 cells total), marker expression was detected in 2/3 samples indicating some loss of cells during the immunobead isolation.

In the main part of this study, the expression of the panel of 5 RT-PCR markers (TACSTD1, EPHB4, ELF3, EGFR, and MGB1) was determined after immunobead enrichment of circulating epithelial cells in blood samples obtained from 56 early stage breast cancer patients. Circulating epithelial cells were isolated from blood samples based on their ability to bind to the immunobeads via the BerEP4 antibody that recognises the TACSTD1 (EpCAM/EGP2) glycoprotein. Therefore, it was determined that patient samples would only be considered positive for circulating cells if TACSTD1 expression was positive along with expression of one of the other markers.

Using this panel of markers, 20/56 (36%) of patient blood samples had detectable levels of gene expression for at least two of the markers including TACSTD1. As these markers were previously shown to give sensitive and specific identification of tumour cells 8, it can be considered that these patients must have had at least one epithelial cell in that blood sample. Importantly, immunobead isolates from 10 ml blood samples obtained from 10 normal donor individuals with no seeded cells were negative for expression of all markers.

Although the IB RT-PCR method is highly sensitive, it is possible that some cells may not be isolated by the immunobeads due to either the death of the cell during immunobead incubation or lack of expression of the EpCAM target antigen. In addition, it is likely there is some heterogeneity in marker gene expression (where some cells may not be expressing a particular gene at that time) in the captured cells. This is demonstrated in the results of this study where not all of the samples that are positive for at least two markers are positive for all five markers and this highlights the need for the use of multiple markers.

TACSTD1 and EPHB4 were expressed in 100% of samples that were positive for two or more markers. As TACSTD1 encodes EpCAM, the target antigen for the BerEP4 antibody, it was expected that all captured tumour cells would express this gene. Previous studies evaluating TACSTD1 expression as a marker of micrometastasis in breast cancer reported expression of this gene in bone marrow and peripheral blood cells of normal individuals 232425. However, those studies used nested-RT-PCR without prior immunobead enrichment. In this study, TACSTD1 was an excellent control marker for use with IB RT-PCR with none of 10 normal control samples expressing the gene after immunobead "enrichment".

EPHB4 has not been used as a marker of disseminated breast tumour cells prior to this study. It has been used in a previous immunobead RT-PCR study screening peripheral blood and lavage samples from patients with colorectal cancer 26. Wu et al (2004) used immunohistochemistry of 94 tumour tissues to show that 82% of breast tumours had moderate to strong expression of EPHB4 and that this was increased with clinical stage and histological grade 27. More recently, siRNA and antisense studies have confirmed that EPHB4 has an essential role in many processes that contribute to cancer cell survival and spread in several cancers including breast cancer 28. EPHB4 was found to be an exceptional marker in the present study, with 100% of positive patient samples showing expression of the gene

EGFR and ELF3 (ESX) were expressed in the majority of positive patient samples (81% and 90% respectively). Both these genes have been reported to be over-expressed in breast cancer 293031. EGFR has been widely used for RT-PCR detection of CTCs 32333435363738. The majority of these studies found EGFR to be highly specific for CTCs with no expression detected in normal control samples. EGFR seems to be particularly associated with basal type breast cancers and also may be a marker of the epithelial to mesenchymal transition often found in CTCs.

The final marker used in this study was MGB1 which has been frequently used for detecting CTCs in breast cancer patients due to its exclusive expression in breast tissue 1521394041424344. In most of these reports, detection of MGB1 was highly sensitive and specific with detection ranging from 11% to 60% of patient samples. In this study, MGB1 performed poorly as a marker of dissemination in comparison to the other 4 markers. Why MGB1 expression was not as readily detected as other markers is unclear, but MGB1 was also the least frequently expressed marker in the single cell assay reported previously 8. It is possible that as MGB1 is a marker of mammary differentiation it may not be as highly expressed in breast tumours with a relatively undifferentiated phenotype as the other markers used here. This hypothesis is supported by a study that found a significant association (p = 0.020) between absence of MGB1 mRNA and grade 3 breast cancers 44. Interestingly, MGB1 expression was not seen in the seven RT-PCR marker positive patients with node negative disease and suggests there is either a low tumour cell burden in the circulation of these patients or there are differences in the biology of node negative tumours.

The relationships between positive RT-PCR marker expression and prognostic indicators were analysed using Fisher's exact test. As the TNM classification system determines stage of disease using tumour size, involvement of lymph nodes, and distant metastasis, the relationship of overall stage of disease and positive expression of markers was examined. Positive results were seen in all stages of disease and included a patient considered to have in situ disease. Analysis showed there were significant associations with marker positivity with more advanced stage of disease (in situ and Stage I versus Stage II p = 0.02) and even within a stage (Stage IIa versus Stage IIb p = 0.03).

Tumour size was not strongly associated with marker positivity suggesting that even small tumours can shed cells into the circulation. Similar results regarding tumour size have also been observed in studies of breast cancer patients with tumour cells in their bone marrow 4546. In contrast, a study using a quantitative RT-PCR multi-marker assay of blood with tumour specific markers reported a strong correlation with both clinical stage of disease and tumour size 47.

Patients with Grade 3 tumours were more likely to be marker positive in this study than patients with more differentiated tumours. The majority (40%) of RT-PCR positive patients had Grade 3 tumours.

Lymph node involvement was strongly associated with marker positivity, Lymph node involvement has also been associated with the presence of micrometastatic cells in the bone marrow 48. However, a significant proportion (17%) of node negative patients had CTCs detected by IB RT-PCR. This is lower than the proportion (26%) of node negative patients that had bone marrow micrometastases 48. These rates are similar to the reported 20–30% of node negative patients that subsequently relapse or die.

The data from this study support the concept that LVI is a good predictor that tumour cells are likely to have entered the circulation. However, CTCs can be detected among patients without evidence of lymphatic and or vascular invasion (25% compared to 75% in lymphatic and or vascular invasion positive group). A report of 1,258 patients evaluated the absence or presence of LVI for any significance towards assessing survival 49. Presence of LVI was found to be associated with a significantly worse survival based on 12 year follow-up for those with lymph node negative disease and an even worse survival for those with positive nodes. It was suggested that both LVI and lymph node status were highly independent and combined together would be significant predictors of outcome.

Disease-free survival was not found to be significantly associated with marker status however a definite trend towards poorer disease free survival was observed. It is likely that longer follow-up will reveal a statistically significant survival disadvantage for these patients.

The purpose of this study was to evaluate the methodology of detection of CTCs in patients with operable breast cancer. The results are compatible with the hypothesis that CTCs are indicative of a higher risk of recurrence and poorer survival even though statistical significance was not reached. A limitation of the current study is that no reference (housekeeping) genes were used when the study was performed. This does not allow us to conclusively eliminate the possibility that there may have been a small proportion of false negative results. Nevertheless, the multi-marker IB RT-PCR assay has been shown to sensitively detect CTCs in early stage breast cancer patients. A larger prospective study of minimal tumour burden in blood, bone marrow and lymph nodes should provide conclusive evidence of the role of detection of blood-borne CTCs in early stage breast cancer.

Abbreviations

PCR: polymerase chain reaction; RT-PCR: reverse transcriptase polymerase chain reaction; CTCs: circulating tumour cells; PBMNCs: peripheral blood mononuclear cells; IB RT-PCR: immunobead RT-PCR; PBS: phosphate buffered saline; ER: estrogen receptor; PR: progesterone receptor; TNM: tumour node metastasis; LVI: lymphovascular invasion; TACSTD1: tumour-associated calcium signal transducer 1 (also known as epithelial cell adhesion molecule, EpCam,); ELF3: E74-like factor 3 (ets domain transcription factor, epithelial-specific), (also known as ESX, epithelial specific with serine box); EPHB4: EPH receptor B4; EGFR: epidermal growth factor receptor; MGB1: mammaglobin 1; Tm: melting temperature; bp: base pairs; s: sense; as: antisense.

Competing interests

The authors declare that they have no competing interests.

Authors' contributions

MR performed the majority of the experiments, analysed the data and drafted the manuscript. SS assisted with the experiments and the analysis of the data and assisted with the manuscript. DCAW and KP assisted with the design of the project, provided access to clinical samples and were involved in interpreting the data and reviewing the manuscript. MH assisted with the statistical interpretation of the data and reviewed the manuscript. AD was responsible for the overall conception and design of the project, for interpretation of the data and co-writing of the manuscript.

Acknowledgements

This work was funded by grants from the National Health and the Medical Research Council of Australia (350452), Scheme A of the Queen Elizabeth Hospital private practice fund, The Queen Elizabeth Hospital Research Foundation and the National Breast Cancer Foundation. We thank Margaret Colbeck from the Cancer Registry database at The Queen Elizabeth Hospital for her assistance, Ida Candiloro for reviewing the manuscript, and Ed Sage and Peter Bardy for their support through the various stages of this project.

Detection of melanoma cells in peripheral blood by means of reverse transcriptase and polymerase chain reaction Smith B Selby P Southgate J Pittman K Bradley C Blair GE Lancet. 1991 338 8777 1227 1229 10.1016/0140-6736(91)92100-G 1719320 Detection of tyrosine hydroxylase mRNA and minimal neuroblastoma cells by the reverse transcription-polymerase chain reaction Naito H Kuzumaki N Uchino J Kobayashi R Shikano T Ishikawa Y Matsumoto S Eur J Cancer 1991 27 762 765 1676900 Detection of epithelial cancer cells in peripheral blood by reverse transcriptase-polymerase chain reaction Burchill SA Bradbury MF Pittman K Southgate J Smith B Selby P Br J Cancer. 1995 71 2 278 281 7530983 Limitations of reverse-transcriptase polymerase chain reaction analyses for detection of micrometastatic epithelial cancer cells in bone marrow Zippelius A Kufer P Honold G Köllermann MW Oberneder R Schlimok G Riethmüller G Pantel K J Clin Oncol 1997 15 2701 2708 9215843 Limitations of specific reverse-transcriptase polymerase chain reaction markers in the detection of metastases in the lymph nodes and blood of breast cancer patients Bostick PJ Chatterjee S Chi DD Huynh KT Giuliano AE Cote R Hoon DS J Clin Oncol 1998 16 2632 2640 9704713 Immunobead-PCR: a technique for the detection of circulating tumor cells using immunomagnetic beads and the polymerase chain reaction Hardingham JE Kotasek D Farmer B Butler RN Mi JX Sage RE Dobrovic A Cancer Res 1993 53 3455 3458 8101760 Immunobead RT-PCR: a sensitive method for detection of circulating tumor cells Eaton MC Hardingham JE Kotasek D Dobrovic A Biotechniques 1997 22 100 105 8994656 Optimisation of the RT-PCR detection of immunomagnetically enriched carcinoma cells Raynor M Stephenson SA Walsh DC Pittman KB Dobrovic A BMC Cancer 2002 2 14 115840 12031094 10.1186/1471-2407-2-14 Nonparametric estimation from incomplete observations Kaplan EL Meier P J Amer Statist Assoc 1958 53 457 481 10.2307/2281868 Asymptotically efficient rank invariant test procedures (with discussion) Peto R Peto J J Roy Statist Soc A 1972 135 185 206 10.2307/2344317 Significance, detection and markers of disseminated breast cancer cells Lacroix M Endocr Relat Cancer 2006 13 1033 1067 10.1677/ERC-06-0001 17158753 The clinical significance of disseminated tumor cells in breast cancer Slade MJ Coombes RC Nat Clin Pract Oncol. 2007 4 1 30 41 10.1038/ncponc0685 17183354 Detection, clinical relevance and specific biological properties of disseminating tumour cells Pantel K Brakenhoff RH Brandt B Nat Rev Cancer 2008 8 329 340 10.1038/nrc2375 18404148 Is there a role for circulating tumour cells in the management of breast cancer? Hayes DF Smerage J Clin Cancer Res 2008 12 3646 50 10.1158/1078-0432.CCR-07-4481 Prognostic value of the molecular detection of circulating tumor cells using a multimarker reverse transcription-PCR assay for cytokeratin 19, mammaglobin A, and HER2 in early breast cancer Ignatiadis M Kallergi G Ntoulia M Perraki M Apostolaki S Kafousi M Chlouverakis G Stathopoulos E Lianidou E Georgoulias V Mavroudis D Clin Cancer Res 2008 14 2593 600 10.1158/1078-0432.CCR-07-4758 18451221 The detection of breast carcinoma micrometastases in axillary lymph nodes by means of reverse transcriptase-polymerase chain reaction Noguchi S Aihara T Nakamori S Motomura K Inaji H Imaoka S Koyama H Cancer 1994 74 1595 1600 10.1002/1097-0142(19940901)74:5<1595::AID-CNCR2820740516>3.0.CO;2-L 7520351 Detection of metastases in sentinel lymph nodes of breast cancer patients by multiple-marker RT-PCR Bostick PJ Huynh KT Sarantou T Turner RR Qi K Giuliano AE Hoon DS Int J Cancer 1998 79 645 651 10.1002/(SICI)1097-0215(19981218)79:6<645::AID-IJC16>3.0.CO;2-R 9842976 Detection of occult breast cancer micrometastases in axillary lymph nodes using a multimarker reverse transcriptase-polymerase chain reaction panel Lockett MA Baron PL O'Brien PH Elliott BM Robison JG Maitre N Metcalf JS Cole DJ J Am Coll Surg 1998 187 9 16 10.1016/S1072-7515(98)00130-6 9660019 Quantitative real-time RT-PCR detection of breast cancer micrometastasis using a multigene marker panel Mitas M Mikhitarian K Walters C Baron PL Elliott BM Brothers TE Robison JG Metcalf JS Palesch YY Zhang Z Gillanders WE Cole DJ Int J Cancer 2001 93 162 171 10.1002/ijc.1312 11410861 Detection of micrometastases in lymph nodes from patients with breast cancer Branagan G Hughes D Jeffrey M Crane-Robinson C Perry PM Br J Surg 2002 89 86 89 10.1046/j.0007-1323.2001.01970.x 11851670 Multimarker RT-PCR assay for the detection of minimal residual disease in sentinel lymph nodes of breast cancer patients Nissan A Jager D Roystacher M Prus D Peretz T Eisenberg I Freund HR Scanlan M Ritter G Old LJ Mitrani-Rosenbaum S Br J Cancer 2006 94 681 685 16495929 Detection of circulating tumor cells in peripheral blood of breast cancer patients during or after therapy using a multigene real-time RT-PCR assay Zehentner BK Secrist H Hayes DC Zhang X Ostenson RC Loop S Goodman G Houghton RL Persing DH Mol Diagn Ther 2006 10 41 47 16646576 Evaluating GA733-2 mRNA as a marker for the detection of micrometastatic breast cancer in peripheral blood and bone marrow Zhong XY Kaul S Eichler A Bastert G Arch Gynecol Obstet 1999 263 2 6 10.1007/s004040050251 10728619 Evaluation of MUC1 and EGP40 in bone marrow and peripheral blood as a marker for occult breast cancer Zhong XY Kaul S Bastert G Arch Gynecol Obstet 2001 264 177 181 10.1007/s004040000102 11205703 Ectopic expression of target genes may represent an inherent limitation of RT-PCR assays used for micrometastasis detection: studies on the epithelial glycoprotein gene EGP-2 de Graaf H Maelandsmo GM Ruud P Forus A Oyjord T Fodstad O Hovig E Int J Cancer 1997 72 191 196 10.1002/(SICI)1097-0215(19970703)72:1<191::AID-IJC27>3.0.CO;2-L 9212242 Identification of early-stage colorectal cancer patients at risk of relapse post-resection by immunobead reverse transcription-PCR analysis of peritoneal lavage fluid for malignant cells Lloyd JM McIver CM Stephenson SA Hewett PJ Rieger N Hardingham JE Clin Cancer Res 2006 12 417 423 10.1158/1078-0432.CCR-05-1473 16428481 Expression of Ephb2 and Ephb4 in breast carcinoma Wu Q Suo Z Risberg B Karlsson MG Villman K Nesland JM Pathol Oncol Res 2004 10 26 33 10.1007/BF02893405 15029258 Receptor tyrosine kinase EphB4 is a survival factor in breast cancer Kumar SR Singh J Xia G Krasnoperov V Hassanieh L Ley EJ Scehnet J Kumar NG Hawes D Press MF Weaver FA Gill PS Am J Pathol 2006 169 279 293 1698769 16816380 10.2353/ajpath.2006.050889 ESX: a structurally unique Ets overexpressed early during human breast tumorigenesis Chang CH Scott GK Kuo WL Xiong X Suzdaltseva Y Park JW Sayre P Erny K Collins C Gray JW Benz CC Oncogene 1997 14 1617 1622 10.1038/sj.onc.1200978 9129154 A novel epithelial-expressed ETS gene, ELF3: human and murine cDNA sequences, murine genomic organization, human mapping to 1q32.2 and expression in tissues and cancer Tymms MJ Ng AY Thomas RS Schutte BC Zhou J Eyre HJ Sutherland GR Seth A Rosenberg M Papas T Debouck C Kola I Oncogene 1997 15 2449 2462 10.1038/sj.onc.1201427 9395241 Epidermal growth factor-related peptides and their receptors in human malignancies Salomon DS Brandt R Ciardiello F Normanno N Crit Rev Oncol Hematol 1995 19 183 232 10.1016/1040-8428(94)00144-I 7612182 Detection of CK19, CK20 and EGFR mRNAs in peripheral blood of carcinoma patients: correlation with clinical stage of disease Gradilone A Gazzaniga P Silvestri I Gandini O Trasatti L Lauro S Frati L Aglianò AM Oncol Rep 2003 10 217 222 12469172 Epidermal growth factor receptor mRNA in peripheral blood of patients with pancreatic, lung, and colon carcinomas detected by RT-PCR Clarke LE Leitzel K Smith J Ali SM Lipton A Int J Oncol 2003 22 425 430 12527944 Detection of epidermal growth factor receptor mRNA in peripheral blood: a new marker of circulating neoplastic cells in bladder cancer patients Gazzaniga P Gandini O Giuliani L Magnanti M Gradilone A Silvestri I Gianni W Gallucci M Frati L Aglianò AM Clin Cancer Res 2001 7 577 583 11297251 Maspin and mammaglobin genes are specific markers for RT-PCR detection of minimal residual disease in patients with breast cancer Corradini P Voena C Astolfi M Delloro S Pilotti S Arrigoni G Bregni M Pileri A Gianni AM Ann Oncol 2001 12 1693 1698 10.1023/A:1013573108945 11843246 Mammaglobin gene expression: a superior marker of breast cancer cells in peripheral blood in comparison to epidermal-growth-factor receptor and cytokeratin-19 Grünewald K Haun M Urbanek M Fiegl M Müller-Holzner E Gunsilius E Dünser M Marth C Gastl G Lab Invest 2000 80 1071 1077 10908152 Detection of circulating tumor cells in carcinoma patients by a novel epidermal growth factor receptor reverse transcription-PCR assay De Luca A Pignata S Casamassimi A D'Antonio A Gridelli C Rossi A Cremona F Parisi V De Matteis A Normanno N Clin Cancer Res 2000 6 1439 1444 10778975 Detection of cancer cells in peripheral blood of breast cancer patients using reverse transcription-polymerase chain reaction for epidermal growth factor receptor Leitzel K Lieu B Curley E Smith J Chinchilli V Rychlik W Lipton A Clin Cancer Res 1998 4 3037 3043 9865918 Prognostic Value of the Molecular Detection of Circulating Tumor Cells Using a Multimarker Reverse Transcription-PCR Assay for Cytokeratin 19, Mammaglobin A, and HER2 in Early Breast Cancer Ignatiadis M Kallergi G Ntoulia M Perraki M Apostolaki S Kafousi M Chlouverakis G Stathopoulos E Lianidou E Georgoulias V Mavroudis D Clin Cancer Res 2008 14 2593 2600 10.1158/1078-0432.CCR-07-4758 18451221 Evaluation of expression based markers for the detection of breast cancer cells Brown NM Stenzel TT Friedman PN Henslee J Huper G Marks JR Breast Cancer Res Treat 2006 97 41 47 10.1007/s10549-005-9085-8 16319979 Mammaglobin remains a useful marker for the detection of breast cancer cells in peripheral blood Zach O Lutz D J Clin Oncol 2005 23 3160 10.1200/JCO.2005.05.176 15860886 Lack of correlation between expression of human mammaglobin mRNA in peripheral blood and known prognostic factors for breast cancer patients Lin YC Chen SC Hsueh S Lo YF Chow-Wu YH Liaw IC Cheng AJ Cancer Sci 2003 94 99 102 10.1111/j.1349-7006.2003.tb01359.x 12708482 Human mammaglobin RT-PCR assay for detection of occult breast cancer cells in hematopoietic products Silva AL Tomé MJ Correia AE Passos-Coelho JL Ann Oncol 2002 13 422 429 10.1093/annonc/mdf107 11996474 Relationship between human mammaglobin mRNA expression in breast cancer tissue and clinico-pathologic features of the tumors Roncella S Ferro P Bacigalupo B Dessanti P Giannico A Gorji N Moroni M Tozzini S Pensa F Gianquinto D Fais F Pronzato P Fedeli F J Exp Clin Cancer Res 2006 25 65 72 16761620 A summary of two clinical studies on tumor cell dissemination in primary and metastatic breast cancer: methods, prognostic significance and implication for alternative treatment protocols (Review) Kasimir-Bauer S Oberhoff C Schindler AE Seeber S Int J Oncol 2002 20 1027 1034 11956600 Micrometastatic breast cancer cells in bone marrow at primary surgery: prognostic value in comparison with nodal status Diel IJ Kaufmann M Costa SD Holle R von Minckwitz G Solomayer EF Kaul S Bastert G J Natl Cancer Inst 1996 88 1652 1658 10.1093/jnci/88.22.1652 8931609 Detection of occult metastatic breast cancer cells in blood by a multimolecular marker assay: correlation with clinical stage of disease Taback B Chan AD Kuo CT Bostick PJ Wang HJ Giuliano AE Hoon DS Cancer Res 2001 61 8845 8850 11751407 A pooled analysis of bone marrow micrometastasis in breast cancer Braun S Vogl FD Naume B Janni W Osborne MP Coombes RC Schlimok G Diel IJ Gerber B Gebauer G Pierga JY Marth C Oruzio D Wiedswang G Solomayer EF Kundt G Strobl B Fehm T Wong GY Bliss J Vincent-Salomon A Pantel K N Engl J Med 2005 353 793 802 10.1056/NEJMoa050434 16120859 Lymph node status combined with lymphovascular invasion creates a more powerful tool for predicting outcome in patients with invasive breast cancer Woo CS Silberman H Nakamura SK Ye W Sposto R Colburn W Waisman JR Silverstein MJ Am J Surg 2002 184 337 340 10.1016/S0002-9610(02)00950-9 12383896